NCT07397741

Brief Summary

Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs. The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to contribute to the recruitment of Th17 cells, which in turn enhances IL 17A production and promotes the inflammatory cycle.

Trial Health

65
Monitor

Trial Health Score

Automated assessment based on enrollment pace, timeline, and geographic reach

Enrollment
60

participants targeted

Target at P25-P50 for all trials

Timeline
8mo left

Started Mar 2026

Shorter than P25 for all trials

Status
not yet recruiting

Health score is calculated from publicly available data and should be used for screening purposes only.

Trial Relationships

Click on a node to explore related trials.

Study Timeline

Key milestones and dates

Study Progress29%
Mar 2026Mar 2027

First Submitted

Initial submission to the registry

January 30, 2026

Completed
10 days until next milestone

First Posted

Study publicly available on registry

February 9, 2026

Completed
20 days until next milestone

Study Start

First participant enrolled

March 1, 2026

Completed
11 months until next milestone

Primary Completion

Last participant's last visit for primary outcome

February 1, 2027

Expected
28 days until next milestone

Study Completion

Last participant's last visit for all outcomes

March 1, 2027

Last Updated

February 9, 2026

Status Verified

February 1, 2026

Enrollment Period

11 months

First QC Date

January 30, 2026

Last Update Submit

February 5, 2026

Conditions

Rhematoid Arthritis

Keywords

CCR6/CCL20 axis in Rheumatoid arthritis

Outcome Measures

Primary Outcomes (1)

  • assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individuals

    assessment of CCR6 gene expression level using quantitative real time PCR

    within 3 days of samples collection

Secondary Outcomes (1)

  • Measure the plasma levels of CCL20

    within 3 days after samples collection

Study Arms (2)

Group I

Patients with Rheumatoid Arthritis

Genetic: Gene expression by quantitative Real Time PCR

Group II

apparently healthy controls with no chronic illness of matched age and sex

Genetic: Gene expression by quantitative Real Time PCR

Interventions

Gene expression by quantitative Real Time PCRGENETIC

Sample collection: * 5 ml peripheral blood will be collected under sterile conditions. 1-Gene Expression Assay * Total RNA Extraction * cDNA Synthesis * Gene Expression Analysis: o Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC * Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATGAGCTTGACAAAG 2-Assesment of CCL20 plasma level * Using Enzyme Linked Immunosorbent Assay kit (ELISA).

Group IGroup II

Eligibility Criteria

Age18 Years - 60 Years
Sexall
Healthy VolunteersYes
Age GroupsAdult (18-64)
Sampling MethodProbability Sample
Study Population

Patients with Rheumatoid Arthritis aged from 18 years to 60 years, in Rheumatology and Rehabilitation department of Sohag University Hospital and healthy controls of matched age and sex

You may qualify if:

  • Adults (18-60 years) diagnosed with RA according to the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2010 classification criteria for RA by an expert rheumatologist.

You may not qualify if:

  • Patients with co-existing infections or other autoimmune diseases.

Contact the study team to confirm eligibility.

Sponsors & Collaborators

Related Publications (3)

  • Conforti A, Di Cola I, Pavlych V, Ruscitti P, Berardicurti O, Ursini F, Giacomelli R and Cipriani P (2021): Beyond the joints, the extra-articular manifestations in rheumatoid arthritis. Autoimmun Rev 20: 102735.

    BACKGROUND

  • 2- Ciofani M, Madar A, Galan C, Sellars M, Mace K, Pauli F, Agarwal A, Huang W, Parkhurst CN, Muratet M, et al (2012): A vali dated regulatory network for Th17 cell specification. Cell 151: 289-303.

    BACKGROUND

  • 1- Al Obaidi MJ and Al Ghurabi BH: Potential role of NLRP3 inflammasome activation in the pathogenesis of periodontitis patients with type 2 diabetes mellitus. J Med Chem Sci 6: 522-531, 2023.

    BACKGROUND

Central Study Contacts

Salma Khalaf Abdelmageed, Assistant Lecturer

CONTACT

01091285241salma011101@med.sohag.edu.eg

Study Design

Study Type
observational
Observational Model
CASE CONTROL
Time Perspective
CROSS SECTIONAL
Sponsor Type
OTHER
Responsible Party
PRINCIPAL INVESTIGATOR
PI Title
Assistant lecturer of medical biochemistry

Study Record Dates

First Submitted

January 30, 2026

First Posted

February 9, 2026

Study Start

March 1, 2026

Primary Completion (Estimated)

February 1, 2027

Study Completion (Estimated)

March 1, 2027

Last Updated

February 9, 2026

Record last verified: 2026-02