Association Between Ferroptosis and Epilepsy

NCT05269901 | Completed

• 1 other identifier: 2022/2/21
• Study Type: observational
• Target: 40
• Locations: 1 country
• Sites: 1

Brief Summary

Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy. Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death. The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions. Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability. In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant. Therefore, it is necessary to develop a novel therapy to treat epilepsy. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.

Conditions

Epilepsy

Keywords

school-aged children; ferroptosis; epilepsy; GPX4

Outcome Measures

Primary Outcomes (1)

• Rt-qPCR

  Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow: GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC

  Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.

Secondary Outcomes (1)

• Western blot

  Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.

Study Arms (2)

Seizures group

20 newly diagnosed untreated school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics.

Genetic: SLC7A11, GPX4, P53

Healthy control group

20 age-matched healthy school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics.

Genetic: SLC7A11, GPX4, P53

Interventions

SLC7A11, GPX4, P53 GENETIC

Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups

Healthy control group; Seizures group

Eligibility Criteria

• Age: 6 Years - 12 Years
• Sex: all
• Healthy Volunteers: Yes
• Age Groups: Child (0-17)
• Sampling Method: Non-Probability Sample

Study Population

school-aged children who admitted to our hospital from Jan 20, 2021 to Jan 1, 2022

You may qualify if:

• Aged between 6 and 12 years old
• Newly diagnosed untreated epilepsy

You may not qualify if:

• Treated with medicine or another therapy
• Had history of cancer diseases
• Had history of endocrine diseases
• Healthy control group
• \. Aged between 6 and 12 years old
• Had history of epilepsy
• Had history of cancer diseases
• Had history of endocrine diseases

Sponsors & Collaborators

• Affiliated Hospital of Jiangnan University: lead

Study Sites (1)

Affiliated Hospital of JiangNan University, Department of Pediatrics

Wuxi, Jiangsu, 226600, China

Location

Biospecimen

Retention: SAMPLES WITH DNA

school-aged children peripheral blood

MeSH Terms

Conditions

Epilepsy

Interventions

Phospholipid Hydroperoxide Glutathione Peroxidase; Genes, p53

Condition Hierarchy (Ancestors)

Brain Diseases; Central Nervous System Diseases; Nervous System Diseases

Intervention Hierarchy (Ancestors)

Glutathione Peroxidase; Peroxidases; Oxidoreductases; Enzymes; Enzymes and Coenzymes; Selenoproteins; Proteins; Amino Acids, Peptides, and Proteins; Genes, Tumor Suppressor; Genes, Neoplasm; Genes; Genome Components; Genome; Genetic Structures; Genetic Phenomena; Genes, Recessive

Study Officials

• YueYing Liu

  Affiliated Hospital of JiangNan University, department of pediatrics

  STUDY DIRECTOR

Study Design

• Study Type: observational
• Observational Model: CASE CONTROL
• Time Perspective: CROSS SECTIONAL
• Sponsor Type: OTHER
• Responsible Party: SPONSOR

Study Record Dates

• First Submitted: February 23, 2022
• First Posted: March 8, 2022
• Study Start: January 20, 2021
• Primary Completion: November 15, 2021
• Study Completion: January 1, 2022
• Last Updated: April 15, 2022

Record last verified: 2022-02

Data Sharing

• IPD Sharing: Will not share

Locations

CN (1)