Clinical, Psychological and Genetic Characteristics in Dermatological Patients

NCT03831646 | Completed

• 1 other identifier: 4
• Study Type: observational
• Target: 150
• Locations: 1 country
• Sites: 1

Brief Summary

Atopic dermatitis (AD) and psoriasis (PS) are chronic, relapsing dermatological disorders with a high rate of psychiatric co-morbid pathology represented with depression. Brain Derived Neurotrophic Factor (BDNF) belongs to the neurotrophin family and widely studied in pathophysiology of psychiatric and dermatological disorders. A biological stress response system by altered hypothalamic-pituitary-adrenal (HPA) axis as well hypothalamic-pituitary-gonadal (HPG) axis may contribute to dermatoses and psychiatric disorders development. Various factors including gender, genetic, psychological stress, socioeconomic factors also affect the course of dermatoses. A 10-week, case-control study evaluate clinical, psychological and biochemical parameters in AD and PS patients, and healthy control volunteers (HC) depending on gender and BDNF rs6265 gene polymorphism. All parameters are evaluated twice: at disease exacerbation (study baseline) and week 10. The following methods are conducted: assessment of dermatological status, using Scoring of Atopic Dermatitis (SCORAD) and Psoriasis Area and Severity Index (PASI); assessment of depression and anxiety according to DSM-V criteria and with Hamilton Depression Rating Scale (HAM-D) and with Hamilton Anxiety Rating Scale (HAM-A); analysis of serum BDNF (ng/ml), cortisol (nmol/L), testosterone (ng/dL) and IgE levels (IU/ml, AD only); DNA extraction and genotyping of BDNF variants.The study will last during 4-5 months.

Conditions

Atopic Dermatitis; Psoriasis

Keywords

atopic dermatitis; psoriasis; brain-derived neurotrophic factor; depression; gender; immunoglobulin E; cortisol; testosterone

Outcome Measures

Primary Outcomes (15)

• Assessment of change in the severity of atopic dermatitis after conventional treatment from study onset (baseline) at week 10

  Assessment of atopic dermatitis severity is conducted using Scoring of Atopic Dermatitis (SCORAD) index. SCORAD index formula is: A/5 + 7B/2 + C. In this formula A is defined as the extent (0-100), B is defined as the intensity (0-18) and C is defined as the subjective symptoms (0-20). The maximum SCORAD score is 103. SCORAD \<23 - mild AD; SCORAD from 23 to 63 - moderate AD; SCORAD\> 63 - severe AD.

  At disease onset (study baseline) and at week 10

• Assessment of change in the severity of psoriasis after conventional treatment from study onset (baseline) at week 10

  Assessment of the psoriasis severity is conducted using Psoriasis Area and Severity Index (PASI). The patient's body is divided into four sections (head (H) (10% of a person's skin); arms (A) (20%); trunk (T) (30%); legs (L) (40%)). The percent of skin lesions of each area is assessed as follows: 0 (0% of involved area); 1 (\< 10%); 2 (10-29%); 3 (30-49%); 4 (50-69%); 5 (70-89%); 6 (90-100%). Further, for each region, the intensity of 3 clinical signs is evaluated - redness, thickness and scaling and assessed as follows: 0 - no lesions,1 - easy, 2 - moderate, 3 - severe, 4 - very severe. The sum of all three severity parameters is calculated for each section, multiplied by the area score for that area and multiplied by weight of respective section (0.1 for head, 0.2 for arms, 0.3 for body, 0.4 for legs). PASI range is from 0 (no disease) to 72 (maximum disease). The severity of psoriasis is assessed as follows: PASI \<20 - mild; PASI from 20 to 50 - moderate; PASI\> 50 - severe

  At disease onset (study baseline) and at week 10

• Assessment of change in the severity of depression in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

  Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

  At disease onset (study baseline) and week 10

• Assessment of the severity of depression in healthy controls (HC)

  Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

  At disease onset (study baseline)

• Assessment of change in the severity of anxiety in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

  Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

  At disease onset (study baseline) and week 10

• Assessment of the severity of anxiety in HC

  Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

  At disease onset (study baseline)

• Evaluation of changes in serum immunoglobulin E (IgE, IU/ml) levels from study onset (baseline) at week 10 in atopic dermatitis patients

  The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

  At disease onset (study baseline) and week 10

• Analysis of serum IgE (IU/ml) levels in HC

  The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

  At disease onset (study baseline)

• Evaluation of changes in serum Brain Derived Neurotrophic Factor (BDNF, ng/ml) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

  Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

  At disease onset (study baseline) and week 10

• Analysis of serum BDNF (ng/ml) levels in HC

  Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

  At disease onset (study baseline)

• Evaluation of changes in cortisol (nmol/L) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

  The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

  At disease onset (study baseline) and week 10

• Analysis of serum cortisol (nmol/L) levels in HC

  The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

  At disease onset (study baseline)

• Evaluation of changes in testosterone (ng/dL) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

  The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

  At disease onset (study baseline) and week 10

• Analysis of serum testosterone (ng/dL) levels in HC

  The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

  At disease onset (study baseline)

• DNA extraction in AD, PS and HC

  DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC

  At disease onset (study baseline)

Secondary Outcomes (10)

• Assessment and comparison (Unpaired t-test) of SCORAD scores in extrinsic atopic dermatitis (EAD, IgE level above the normal) and intrinsic atopic dermatitis (IAD, normal IgE level) patients compared with baseline after conventional treatment at week 10

  At disease onset (study baseline) and week 10

• Assessment and comparison (Unpaired t-test) of PASI scores in psoriasis patients compared with baseline after conventional treatment at week 10 in accordance with BDNF gene polymorphism (Val/Val; Val/Met;Met/Met) and gender(males, females)

  At disease onset (study baseline) and week 10

• Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-D scores in EAD, IAD, PS and HC

  At disease onset (study baseline) and week 10

• Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-A scores in EAD, IAD,PS and HC

  At disease onset (study baseline) and week 10

• Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum BDNF (ng/ml) levels in EAD, IAD,PS and HC

  At disease onset (study baseline) and at week 10

Study Arms (1)

dermatological patients

atopic dermatitis and psoriasis patients with mild and moderate severity of dermatoses in the stage of exacerbation

Eligibility Criteria

• Age: 18 Years+
• Gender Eligibility Details: AD and PS patients will be divided by gender for assessment of clinical, psychological and biochemical parameters and subsequent comparison with appropriate HC
• Healthy Volunteers: Yes
• Age Groups: Adult (18-64), Older Adult (65+)
• Sampling Method: Probability Sample

Study Population

Atopic dermatitis and psorisis patiens older than 18 years with mild and moderate forms of disease, and healthy volunteers

You may qualify if:

• mild and moderate atopic dermatitis and psoriasis
• age of patients over 18 years
• no systemic therapy (glucocorticosteroids, immunosuppressants and psychotropic drugs) within the month prior the study and blood sampling
• no history of mental or other dermatological disorders
• no unstable non-dermatological medical conditions
• good general physical health
• no pregnancy

You may not qualify if:

• pregnancy
• unstable non-dermatological medical conditions
• severe forms of AD and PS

Sponsors & Collaborators

• Astana Medical University: lead
• Ariel University: collaborator
• Tirat Carmel Mental Health Center: collaborator
• Medical Centre Hospital of the President's Affairs Administration, Republic of Kazakhstan: collaborator

Study Sites (1)

Tatyana Vinnik

Astana, 000010, Kazakhstan

Location

Related Links

• Association of HPA axis hormones with copeptin after psychological stress differs by sex
• How does epidermal pathology interact with mental state?
• The roles of BDNF in the pathophysiology of major depression and in antidepressant treatment
• Increase in serum brain-derived neurotrophic factor in met allele carriers of the BDNF Val66Met polymorphism is specific to males
• Interaction between the BDNF gene Val/66/Met polymorphism and morning cortisol levels as a predictor of depression in adult women
• Association between atopic dermatitis, depression, and suicidal ideation: A systematic review and meta-analysis
• HPA axis in major depression: cortisol, clinical symptomatology and genetic variation predict cognition
• Childhood atopic dermatitis-Brain-derived neurotrophic factor correlates with serum eosinophil cationic protein and disease severity
• Depression- and anxiety-like behaviour is related to BDNF/TrkB signalling in a mouse model of psoriasis
• Serum testosterone levels and symptom-based depression subtypes in men

Biospecimen

Retention: SAMPLES WITH DNA

DNA are extracted using Wizard Genomic DNA purification (Promega, US, A1120) and measured using NanoDrop 8000 (Thermo Scientific, US). Amplification of rs6265 allelic variants will be performed in a Stratagene Mx 3000P (Agilent Technologies, US) with custom primers (TCCTCATCCAACAGCTCTTCTATCA \[C/T\] GTGTTCGAAAGTGTCAGCCAATGAT; TaqMan SNP Genotyping Assay, ThermoFisher Scientific, US).

MeSH Terms

Conditions

Dermatitis, Atopic; Psoriasis; Depression; Coitus

Condition Hierarchy (Ancestors)

Skin Diseases, Genetic; Genetic Diseases, Inborn; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Dermatitis; Skin Diseases; Skin and Connective Tissue Diseases; Skin Diseases, Eczematous; Hypersensitivity, Immediate; Hypersensitivity; Immune System Diseases; Skin Diseases, Papulosquamous; Behavioral Symptoms; Behavior; Sexual Behavior

Study Officials

• Tatyana Vinnik, MD, PhD

  Astana Medical University

  PRINCIPAL INVESTIGATOR

Study Design

• Study Type: observational
• Observational Model: CASE CONTROL
• Time Perspective: PROSPECTIVE
• Sponsor Type: OTHER
• Responsible Party: PRINCIPAL INVESTIGATOR
• PI Title: Assistant Professor

Study Record Dates

• First Submitted: January 30, 2019
• First Posted: February 6, 2019
• Study Start: January 20, 2019
• Primary Completion: July 10, 2019
• Study Completion: July 30, 2019
• Last Updated: August 20, 2019

Record last verified: 2019-08

Data Sharing

• IPD Sharing: Will not share

Locations

KA (1)